Sequence ID | >WENV181895412 |
Genome ID | OGXR01008562 |
Search identical group | |
Phylum/Class | [OGXR] human gut metagenome; faeces |
Species | |
Start position on genome | 2898 |
End posion on genome | 2822 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
ctctaaatat |
tRNA gene sequence |
GGGCTCATAGCTCAGATGGTTAGAGCGCACGCCTGATAAGCGTGAGGTCGATGGTTCGAT |
Downstream region at tRNA end position |
atcttagatg |
Secondary structure (Cloverleaf model) | >WENV181895412 Ile GAT t ACCA atcttagatg G - C G - C G - C C - G T - A C - G A - T T T T T T A C C A A G A A + | | | | G T C T C G G A T G G C G | | | | T T G G A G C T T A G AGGTC C - G A - T C - G G - C C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |