Sequence ID | >WENV181898590 |
Genome ID | OGXT01007545 |
Search identical group | |
Phylum/Class | [OGXT] human gut metagenome; faeces |
Species | |
Start position on genome | 2276 |
End posion on genome | 2204 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
ccccagttaa |
tRNA gene sequence |
GGGTGTGTAGCTCAGGTGGTAGAGCACTTGACTTTTAATCAAGTTGTCCGGGGTTCGAAT |
Downstream region at tRNA end position |
gataagcatg |
Secondary structure (Cloverleaf model) | >WENV181898590 Lys TTT a Agtt gataagcatg G - C G + T G - C T + G G - C T - A G - C T A T G C C C C A G G A A | | | | | G T C T C G C G G G G C G | | | | T T G G A G C T A A TTGTC C - G T - A T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |