Sequence ID | >W141188718 |
Genome ID | AYMW01000002 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Betaproteobacteria bacterium MOLA814 [AYMW] |
Start position on genome | 611800 |
End posion on genome | 611716 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
aaagacacat |
tRNA gene sequence |
GCCGTCGTGGTGAAATTGGTAGACACGCTATCTTGAGGGGGTAGTGGCGAAAGCTGTGCG |
Downstream region at tRNA end position |
tcacagttca |
Secondary structure (Cloverleaf model) | >W141188718 Leu GAG t ACCA tcacagttca G - C C - G C - G G - C T - A C - G G - C T G T C G C T C A T A A G | | | | | G T A G T G G C G A G C G | | | T T G A C A C T A G G TGGCGAAAGCTGT C - G T - A A - T T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |