Sequence ID | >WENV181906942 |
Genome ID | OGXZ01012530 |
Search identical group | |
Phylum/Class | [OGXZ] human gut metagenome; faeces |
Species | |
Start position on genome | 834 |
End posion on genome | 909 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
tctcatatat |
tRNA gene sequence |
GCACCATTAGCTCAGTTGGTAGAGCAACTGACTCTTAATCAGTGGGTCCTGGGTTCGAGT |
Downstream region at tRNA end position |
aaaatagcct |
Secondary structure (Cloverleaf model) | >WENV181906942 Lys CTT t ACCA aaaatagcct G - C C - G A - T C - G C - G A - T T - A T G T G C C C C A T G A A | | | | G T C T C G C T G G G C G | | | | T T G G A G C T A A GGGTC A - T C - G T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |