Sequence ID | >WENV181907642 |
Genome ID | OGYA01001413 |
Search identical group | |
Phylum/Class | [OGYA] human gut metagenome; faeces |
Species | |
Start position on genome | 11266 |
End posion on genome | 11181 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ttcctaaagt |
tRNA gene sequence |
GGAGGGGTTCCCGAGTGGCCAAAGGGAACAGACTGTAAATCTGTCGTCGTGAGACTTCGG |
Downstream region at tRNA end position |
gatgaaaaaa |
Secondary structure (Cloverleaf model) | >WENV181907642 Tyr GTA t ACCA gatgaaaaaa G - C G - C A - T G - C G - C G - C G - C T A T C C T C C A T G A T | | | | | A G G C C C G G A G G C G | | | T T C A G G G C A A A CGTCGTGAGACTTC A - T C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |