Sequence ID | >WENV181914619 |
Genome ID | OGYF01000561 |
Search identical group | |
Phylum/Class | [OGYF] human gut metagenome; faeces |
Species | |
Start position on genome | 7868 |
End posion on genome | 7792 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
aacgccaaac |
tRNA gene sequence |
GCGCCGGTAGCTCAACTGGATAGAGCATCGGACTACGGATCCGAAGGTTACGAGTTCAAA |
Downstream region at tRNA end position |
tattactgaa |
Secondary structure (Cloverleaf model) | >WENV181914619 Arg ACG c GCCA tattactgaa G - C C - G G - C C - G C - G G - C G - C T A T T G T T C A C A A A | | + | | A T C T C G A C G A G C G | | | | T T G G A G C A T A A AGGTT T - A C - G G - C G - C A - T C A T G A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |