Sequence ID | >WENV181923889 |
Genome ID | OGYL01002632 |
Search identical group | |
Phylum/Class | [OGYL] human gut metagenome; faeces |
Species | |
Start position on genome | 75 |
End posion on genome | 2 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
tatgtgtttt |
tRNA gene sequence |
GCAGACATAGTACATCGGTAGTATATCAGCTTCCCAAGCTGAGGAGGCGGGTTCGATTCC |
Downstream region at tRNA end position |
annnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV181923889 Gly CCC t TCCA annnnnnnnn G - C C - G A - T G - C A C C - G A - T T T T T G C C C A T A A + | | | | G C C A T G G C G G G C G | | | + T T G G T A T T A A GGAG T - A C - G A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |