Sequence ID | >WENV181924936 |
Genome ID | OGYL01080517 |
Search identical group | |
Phylum/Class | [OGYL] human gut metagenome; faeces |
Species | |
Start position on genome | 76 |
End posion on genome | 1 |
Amino Acid | Ile2 |
Anticodon | CAT |
Upstream region at tRNA start position |
ttgagtctat |
tRNA gene sequence |
GGGCCATTAGCTCAGTTGGTCAGAGCCACCGGCTCATAACCGGTTGGTCCGGGGTTCGAG |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV181924936 Ile2 CAT t ACCn nnnnnnnnnn G - C G - C G - C C - G C - G A A T - A T G T G T C C C A T G A A | + | | | G T C T C G C G G G G C G | | | | T T G G A G C T C A C TGGTC A - T C - G C - G G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |