Sequence ID | >WENV181931619 |
Genome ID | OGYQ01001144 |
Search identical group | |
Phylum/Class | [OGYQ] human gut metagenome; faeces |
Species | |
Start position on genome | 15267 |
End posion on genome | 15196 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
atgaagatga |
tRNA gene sequence |
GGCTCCATGGTCAAGTGGTTAAGACACCGCCCTTTCACGGCGGTAACACGGGTTCAAATC |
Downstream region at tRNA end position |
ttttgttact |
Secondary structure (Cloverleaf model) | >WENV181931619 Glu TTC a Atct ttttgttact G - C G + T C - G T - A C - G C - G A - T T A T T G C C C A T G A G | | | | | A G A C T G A C G G G C G | | | T T T A G A C T A A TAAC C - G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |