Sequence ID | >WENV181942516 |
Genome ID | OGYZ01000355 |
Search identical group | |
Phylum/Class | [OGYZ] human gut metagenome; faeces |
Species | |
Start position on genome | 27462 |
End posion on genome | 27386 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
ccaccactac |
tRNA gene sequence |
GGAGCGGTAGTTAAGACGGTTATAACGCCGGCCTGTCACGCCGGAGGCCGAGGGTTCGAG |
Downstream region at tRNA end position |
taatcacgca |
Secondary structure (Cloverleaf model) | >WENV181942516 Asp GTC c GCCA taatcacgca G - C G - C A - T G - C C - G G - C G - C T G T T T C C C A A G A A + | | | | G C A T T G G A G G G C G | | | | T T G T A A C T T A G AGGCC C - G C - G G - C G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |