Sequence ID | >WENV181965582 |
Genome ID | OGZT01001533 |
Search identical group | |
Phylum/Class | [OGZT] human gut metagenome; faeces |
Species | |
Start position on genome | 14502 |
End posion on genome | 14413 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
tgcacgacgc |
tRNA gene sequence |
GGAGAGGTGTCCGAGCTGGTCGAAGGAGCACGATTGGAAATCGTGTGTACTCAAAAGGTA |
Downstream region at tRNA end position |
ttagaagtaa |
Secondary structure (Cloverleaf model) | >WENV181965582 Ser GGA c GCCA ttagaagtaa G - C G - C A - T G - C A - T G - C G - C T A T C C C T C A T C G A G | | | | | G G G C C T G G G A G C G | | | T T T A G G A C G A G TGTACTCAAAAGGTACC C - G A - T C - G G - C A - T T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |