Sequence ID | >WENV181969728 |
Genome ID | OGZX01000369 |
Search identical group | |
Phylum/Class | [OGZX] human gut metagenome; faeces |
Species | |
Start position on genome | 25546 |
End posion on genome | 25631 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
taggcgcaaa |
tRNA gene sequence |
GGGTAGATGTCTGAGCGGTCTAAAGAGACGGTCTTGAAAACCGTTGAGGTGCAAGCCTCC |
Downstream region at tRNA end position |
caatcaaggg |
Secondary structure (Cloverleaf model) | >WENV181969728 Ser TGA a GCat caatcaaggg G - C G - C G - C T + G A - T G - C A - T T A T C G C T C A C G A G | | | | | G G G T C T G C G A G C G | | | T T T A A G A C T A G TGAGGTGCAAGCCTCC A - T C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |