Sequence ID | >WENV181976146 |
Genome ID | OHAD01000364 |
Search identical group | |
Phylum/Class | [OHAD] human gut metagenome; faeces |
Species | |
Start position on genome | 54977 |
End posion on genome | 54901 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
ccaccatgat |
tRNA gene sequence |
GGACCTGTAGCTCAGTTGGTTAGAGCGTCCGGCTGATAACCGGGAGGTCACAAGTTCGAA |
Downstream region at tRNA end position |
tcaaaactgt |
Secondary structure (Cloverleaf model) | >WENV181976146 Ile GAT t ACCA tcaaaactgt G - C G - C A - T C - G C - G T - A G - C T A T T G T T C A T G A A | | | | | G T C T C G A C A A G C G | | | | T T G G A G C T T A G AGGTC T + G C - G C - G G - C G - C C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |