Sequence ID | >WENV181977341 |
Genome ID | OHAD01052354 |
Search identical group | |
Phylum/Class | [OHAD] human gut metagenome; faeces |
Species | |
Start position on genome | 586 |
End posion on genome | 512 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
caaagggtaT |
tRNA gene sequence |
GGGGGCGTAGCTCAGTTGGGAGAGCACCTGCCTTGCAAGCAGGGGGTCACGAGTTCGAAT |
Downstream region at tRNA end position |
ggttgataaa |
Secondary structure (Cloverleaf model) | >WENV181977341 Ala TGC T ATtc ggttgataaa G - C G - C G + T G - C G + T C - G G - C T A T T G C T C A T G A A | | | | | G T C T C G A C G A G C G | | | | T T G G A G C G A A GGGTC C - G C - G T - A G - C C - G C A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |