Sequence ID | >WENV181978730 |
Genome ID | OHAE01059787 |
Search identical group | |
Phylum/Class | [OHAE] human gut metagenome; faeces |
Species | |
Start position on genome | 7 |
End posion on genome | 83 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
nnnnaaatat |
tRNA gene sequence |
GGGCGGTTAGCTCAGTTGGTTAGAGTATCTCGTTGACATCGAGGGGGTCGATGGTTCGAA |
Downstream region at tRNA end position |
tattgtgtga |
Secondary structure (Cloverleaf model) | >WENV181978730 Val GAC t ACCA tattgtgtga G - C G - C G - C C - G G - C G + T T - A T A T T T A C C A T G A A + | | | | G T C T C G G A T G G C G | | | + T T G G A G T T T A A GGGTC T + G C - G T - A C - G G - C T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |