Sequence ID | >WENV181982577 |
Genome ID | OHAH01000461 |
Search identical group | |
Phylum/Class | [OHAH] human gut metagenome; faeces |
Species | |
Start position on genome | 9538 |
End posion on genome | 9452 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
caaaccatgt |
tRNA gene sequence |
GCGCTCGTGGCGGAATTGGTAGACGCGCTAGATTCAGGTTCTAGTGGGGGTTCCCCCGTG |
Downstream region at tRNA end position |
aacaaggccc |
Secondary structure (Cloverleaf model) | >WENV181982577 Leu CAG t ACCA aacaaggccc G - C C - G G - C C - G T + G C - G G - C T G T T T T C C A T A A G + | | | | G T G G C G G A A G G C G | | | T T G A C G C T A G G TGGGGGTTCCCCCGT C - G T - A A - T G - C A - T T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |