Sequence ID | >WENV181983182 |
Genome ID | OHAH01012207 |
Search identical group | |
Phylum/Class | [OHAH] human gut metagenome; faeces |
Species | |
Start position on genome | 603 |
End posion on genome | 530 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
accatccaac |
tRNA gene sequence |
GCGGTAGTAGCTCAGTTGGTAGAGCATCAGCTTCCCAAGCTGAGGGTCACGAGTTCGAGC |
Downstream region at tRNA end position |
tcaggcatta |
Secondary structure (Cloverleaf model) | >WENV181983182 Gly CCC c TCta tcaggcatta G - C C - G G - C G - C T - A A - T G - C C G T C G C T C A T G A A | | | | G T C T C G A C G A G C G | | | | T T G G A G C T A A GGGTC T - A C - G A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |