Sequence ID | >WENV182031351 |
Genome ID | OHCS01011600 |
Search identical group | |
Phylum/Class | [OHCS] human gut metagenome; feces |
Species | |
Start position on genome | 1132 |
End posion on genome | 1205 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
tcggcccaat |
tRNA gene sequence |
TGGGGTATGGTGCAACGGCAGCACGCCTGACTCTGGATCAGGTAATCGAGGTTCAAATCC |
Downstream region at tRNA end position |
ctatcatcgt |
Secondary structure (Cloverleaf model) | >WENV182031351 Gln CTG t GCCA ctatcatcgt T - A G - C G - C G - C G - C T - A A - T T A T G T T C C A A A G | + | | | A C C G T G C G A G G C G | | | | T T G G C A C C A G TAAT C - G C - G T - A G - C A - T C A T G C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |