| Sequence ID | >WENV182031507 |
| Genome ID | OHCS01031997 |
| Phylum/Class | [OHCS] human gut metagenome; feces |
| Species | |
| Start position on genome | 3 |
| End posion on genome | 89 |
| Amino Acid | Leu |
| Anticodon | TAG |
| Upstream region at tRNA start position |
nnnnnnnnct |
| tRNA gene sequence |
GCAAGGGTAGCCAAGCCTGGCCAACGGCGCAGGACTTAGGATCCTGTCCTTAGTGGTCCG |
| Downstream region at tRNA end position |
ttttatcatc |
| Secondary structure (Cloverleaf model) | >WENV182031507 Leu TAG
t ACCA ttttatcatc
G - C
C - G
A - T
A - T
G - C
G - C
G - C T A
T T T C C C A
C C G A A + | | | | A
T A C C G G A G G G C
G | | | T T
G C G G C
C C A A G TCCTTAGTGGTCC
C - G
A - T
G - C
G - C
A - T
C A
T G
T A G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |