Sequence ID | >W141204115 |
Genome ID | AZJG01000001 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Hoylesella oralis CC98A [AZJG] |
Start position on genome | 113275 |
End posion on genome | 113361 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
aagatttgtt |
tRNA gene sequence |
GGAGAGGTGGCGGAATTGGTAGACGCGCTACTTTGAGGGGGTAGTGAAAATTGTTTCGTG |
Downstream region at tRNA end position |
ttatttatta |
Secondary structure (Cloverleaf model) | >W141204115 Leu GAG t ACCA ttatttatta G - C G + T A - T G - C A - T G - C G - C T G T T C C T C A T A A G + | | | | G T G G C G G G G A G C G | | | T T G A C G C T A G G TGAAAATTGTTTCGT C - G T - A A - T C - G T + G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |