Sequence ID | >WENV182068533 |
Genome ID | OHFG01000462 |
Search identical group | |
Phylum/Class | [OHFG] human gut metagenome; feces |
Species | |
Start position on genome | 21796 |
End posion on genome | 21872 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
gcaagtcaaa |
tRNA gene sequence |
GCGCCCGTAGCTCAATTGGATAGAGCGTCTGACTACGGATCAGAAGGTTTGGGGTTCGAA |
Downstream region at tRNA end position |
cttgcatcac |
Secondary structure (Cloverleaf model) | >WENV182068533 Arg ACG a GCCA cttgcatcac G + T C - G G - C C - G C - G C - G G - C T A T A T C C C A T A A A | + | | | G T C T C G T G G G G C G | | | | T T G G A G C A T A G AGGTT T - A C - G T - A G - C A - T C A T G A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |