Sequence ID | >WENV182081438 |
Genome ID | OHGK01000620 |
Search identical group | |
Phylum/Class | [OHGK] human gut metagenome; feces |
Species | |
Start position on genome | 17461 |
End posion on genome | 17377 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
cgcattcgtc |
tRNA gene sequence |
GCGCCTGTGGCGAAATTGGTAGACGCGCCAGACTTAGGATCTGGTGCCGAAAGGCGTACA |
Downstream region at tRNA end position |
tttttccttt |
Secondary structure (Cloverleaf model) | >WENV182081438 Leu TAG c ACCA tttttccttt G - C C - G G - C C - G C - G T - A G - C T G T C G T C C A T A A G | | | | G T A G C G A C A G G C G | | | T T G A C G C T A G G TGCCGAAAGGCGT C - G C - G A - T G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |