| Sequence ID | >W141206764 |
| Genome ID | AZMO01000004 |
| Phylum/Class | Acidithiobacillia |
| Species | Acidithiobacillus thiooxidans A01 [AZMO] |
| Start position on genome | 73167 |
| End posion on genome | 73094 |
| Amino Acid | Gln |
| Anticodon | CTG |
| Upstream region at tRNA start position |
ccgccactct |
| tRNA gene sequence |
TGGGGAATCGTCTAGCGGCAGGACAGCGGACTCTGACTCCGCTAACCGTGGTTCGAATCC |
| Downstream region at tRNA end position |
agaacatagc |
| Secondary structure (Cloverleaf model) | >W141206764 Gln CTG
t GCCA agaacatagc
T - A
G - C
G - C
G - C
G - C
A - T
A - T T A
T G C A C C A
G A C | | | | | G
C T C T G C G T G G C
G + | | | T T
G G G A C
C A A TAAC
G - C
C - G
G - C
G - C
A - T
C C
T A
C T G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |