Sequence ID | >WENV182086475 |
Genome ID | OHGT01015548 |
Search identical group | |
Phylum/Class | [OHGT] human gut metagenome; feces |
Species | |
Start position on genome | 835 |
End posion on genome | 761 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
aggattataT |
tRNA gene sequence |
GGGGGTGTAGCTCAGTTGGGAGAGCACCTGCCTTGCAAGCAGGGGGTCAAGAGTTCGAAT |
Downstream region at tRNA end position |
gatacagtat |
Secondary structure (Cloverleaf model) | >WENV182086475 Ala TGC T ATtt gatacagtat G - C G - C G + T G - C G + T T - A G - C T A T C T C T C A T G A A | | | | G T C T C G A A G A G C G | | | | T T G G A G C G A A GGGTC C - G C - G T - A G - C C - G C A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |