Sequence ID | >W141206779 |
Genome ID | AZMO01000026 |
Search identical group | |
Phylum/Class | Acidithiobacillia |
Species | Acidithiobacillus thiooxidans A01 [AZMO] |
Start position on genome | 31623 |
End posion on genome | 31547 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
gttcgttcat |
tRNA gene sequence |
GCGCCTGTAGCTCAACTGGATAGAGCAACGGCCTTCTAAGCCGTAGGTCAGGGGTTCGAG |
Downstream region at tRNA end position |
ataaagtcaa |
Secondary structure (Cloverleaf model) | >W141206779 Arg TCT t ACCA ataaagtcaa G - C C - G G - C C - G C - G T - A G - C T G T T T C C C A C A A A | + | | | G T C T C G A G G G G C G | | | | T T G G A G C A T A A AGGTC A - T C - G G - C G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |