Sequence ID | >WENV182102201 |
Genome ID | OHHU01026812 |
Search identical group | |
Phylum/Class | [OHHU] human gut metagenome; feces |
Species | |
Start position on genome | 532 |
End posion on genome | 457 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
tatttcttat |
tRNA gene sequence |
GCCGGGGTAGGGTAGGCGGTCATCCTACGGGACTGTGGATCCTGTGACTCGGGTTCAAAT |
Downstream region at tRNA end position |
ttattaaaaa |
Secondary structure (Cloverleaf model) | >WENV182102201 His GTG t CCCA ttattaaaaa G - C C - G C - G G - C G - C G - C G - C T A T G G C T C A G G A A + | | + | A C T G G G T C G G G C G | | + T T G T C C T T C A A TGAC C - G G + T G - C G - C A - T C A T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |