Sequence ID | >WENV182124244 |
Genome ID | OHJQ01007897 |
Search identical group | |
Phylum/Class | [OHJQ] human gut metagenome; feces |
Species | |
Start position on genome | 2120 |
End posion on genome | 2192 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
caaaatacat |
tRNA gene sequence |
GCCGATGTGGCTCAATTGGCAGAGCAGCTGACTTGTAATCAGCAGGTTATCGGTTCGAGT |
Downstream region at tRNA end position |
ttcttatttc |
Secondary structure (Cloverleaf model) | >WENV182124244 Thr TGT t Tttt ttcttatttc G - C C - G C - G G - C A - T T - A G - C T G T T A G C C A T A A G | | | | | G T C T C G A T C G G C G | | | | T T G G A G C C A A AGGTT G - C C - G T - A G - C A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |