Sequence ID | >WENV182128858 |
Genome ID | OHJY01047007 |
Search identical group | |
Phylum/Class | [OHJY] human gut metagenome; feces |
Species | |
Start position on genome | 396 |
End posion on genome | 473 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
tctcttgcaa |
tRNA gene sequence |
CGGGATGTGGCTCAGTTTGGCTAGAGCGCAGCGTTCGGGACGCTGAGGCCGCGCGTTCAA |
Downstream region at tRNA end position |
taaaaaaata |
Secondary structure (Cloverleaf model) | >WENV182128858 Pro CGG a ACCA taaaaaaata C - G G - C G - C G - C A - T T - A G - C T A T C G C G C A T T G A G | | | | | A T C T C G G C G C G C G | | | | T T G G A G C C T A G AGGCC C - G A - T G - C C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |