Sequence ID | >WENV182131859 |
Genome ID | OHKD01012378 |
Search identical group | |
Phylum/Class | [OHKD] human gut metagenome; feces |
Species | |
Start position on genome | 835 |
End posion on genome | 910 |
Amino Acid | Ile2 |
Anticodon | CAT |
Upstream region at tRNA start position |
gttctgcaac |
tRNA gene sequence |
GGGCTCGTAGCTCAGCGGTTAGAGCAGGGGACTCATAATCCCTTGGTCGTAGGTTCGAAT |
Downstream region at tRNA end position |
aaataaagcc |
Secondary structure (Cloverleaf model) | >WENV182131859 Ile2 CAT c ACCA aaataaagcc G + T G - C G - C C - G T + G C - G G - C T A T C A T C C A C G A A | | | | | G G C T C G G T A G G C G | | | | T T T G A G C T A A TGGTC G + T G - C G - C G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |