Sequence ID | >WENV182136382 |
Genome ID | OHKK01000409 |
Search identical group | |
Phylum/Class | [OHKK] human gut metagenome; feces |
Species | |
Start position on genome | 13969 |
End posion on genome | 14043 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
cgccggatat |
tRNA gene sequence |
TGGGATGTCGCCAAGTGGTAAGGCACCAGACTTTGACTCTGGCATTCGTAGGTTCGAGTC |
Downstream region at tRNA end position |
tcgtcggagc |
Secondary structure (Cloverleaf model) | >WENV182136382 Gln TTG t GCCA tcgtcggagc T - A G - C G - C G - C A - T T - A G - C T G T C G T C C A G A C | + | | | G T A C C G G T A G G C G | | | T T G A G G C T A A CATTC C - G C - G A - T G - C A - T C C T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |