Sequence ID | >WENV182140662 |
Genome ID | OHKR01000669 |
Search identical group | |
Phylum/Class | [OHKR] human gut metagenome; feces |
Species | |
Start position on genome | 231 |
End posion on genome | 303 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
gggaccgtta |
tRNA gene sequence |
GACTCGTTAGCTCAGTTGGTAGAGCATCTGACTTTTAATCAGAGGGTCACTGGTTCGAGC |
Downstream region at tRNA end position |
taatatgcgg |
Secondary structure (Cloverleaf model) | >WENV182140662 Lys TTT a Atat taatatgcgg G - C A - T C - G T + G C - G G - C T - A C G T T G A C C A T G A A | | | | | G T C T C G A C T G G C G | | | | T T G G A G C T A A GGGTC T - A C - G T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |