Sequence ID | >W141212983 |
Genome ID | AZRH01000014 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Morganella sp. EGD-HP17 [AZRH] |
Start position on genome | 20986 |
End posion on genome | 20911 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
ccggttttcc |
tRNA gene sequence |
GGGGCTATAGCTCAGCTGGGAGAGCGCTTGCATGGCATGCAAGAGGTCAGGGGTTCGATC |
Downstream region at tRNA end position |
aattcaaacc |
Secondary structure (Cloverleaf model) | >W141212983 Ala GGC c ACCA aattcaaacc G - C G - C G + T G - C C - G T - A A - T C T T T C C C C A C G A A | | | | | G T C T C G A G G G G C G | | | | T T G G A G C G A G AGGTC C - G T - A T - A G - C C - G A T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |