Sequence ID | >WENV182180098 |
Genome ID | OHNN01038176 |
Search identical group | |
Phylum/Class | [OHNN] human gut metagenome; feces |
Species | |
Start position on genome | 546 |
End posion on genome | 460 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
attcctgcac |
tRNA gene sequence |
GCGGGCGTGGCGGAATTGGCAGACGCGTACGGTTCAGGTCCGTATGGGGGCAACCCCATG |
Downstream region at tRNA end position |
ttaaatgaaa |
Secondary structure (Cloverleaf model) | >WENV182180098 Leu CAG c ACCA ttaaatgaaa G - C C - G G - C G - C G - C C - G G - C T G T T T T C C A T A A G + | | | | A T G G C G G A A G G C G | | | T T G A C G C C A G G TGGGGGCAACCCCAT T - A A - T C - G G - C G - C T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |