Sequence ID | >WENV182180198 |
Genome ID | OHNO01000069 |
Search identical group | |
Phylum/Class | [OHNO] human gut metagenome; feces |
Species | |
Start position on genome | 14743 |
End posion on genome | 14669 |
Amino Acid | Ile2 |
Anticodon | CAT |
Upstream region at tRNA start position |
caagatctcg |
tRNA gene sequence |
GGTCCCATAGCTCAGTCGGTTAGAGCACCTGACTCATAATCAGGGAGTCCTTGGTTCAAG |
Downstream region at tRNA end position |
cgatgcgcgc |
Secondary structure (Cloverleaf model) | >WENV182180198 Ile2 CAT g ACag cgatgcgcgc G - C G - C T - A C - G C - G C - G A - T C G T G A A C C A T G A A | | | | | A C C T C G C T T G G C G | | | | T T G G A G C T T A A GAGTC C - G C - G T - A G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |