Sequence ID | >WENV182180473 |
Genome ID | OHNO01001248 |
Search identical group | |
Phylum/Class | [OHNO] human gut metagenome; feces |
Species | |
Start position on genome | 6625 |
End posion on genome | 6549 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
cgcttcatgc |
tRNA gene sequence |
GTGCCTGTAGCTCAGCTGGATAGAGTGCCGCCCTCCGGAGGCGAAGGTCTGGAGTTCGAA |
Downstream region at tRNA end position |
cttttaaaaa |
Secondary structure (Cloverleaf model) | >WENV182180473 Arg CCG c GCCA cttttaaaaa G - C T - A G - C C - G C - G T - A G - C T A T A C C T C A C G A A | | | | | G T C T C G T G G A G C G | | | + T T G G A G T A T A G AGGTC C A C - G G - C C - G C - G C A T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |