Sequence ID | >W141216984 |
Genome ID | AZVH01000001 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Lacrimispora sphenoides DSM 4024 [AZVH] |
Start position on genome | 483792 |
End posion on genome | 483866 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
gattatttaT |
tRNA gene sequence |
GGGGGTGTAGCTCAGTTGGGAGAGCACCTGCCTTGCAAGCAGGGGGTCAAGAGTTCGAAT |
Downstream region at tRNA end position |
gatgtagtta |
Secondary structure (Cloverleaf model) | >W141216984 Ala TGC T ATtt gatgtagtta G - C G - C G + T G - C G + T T - A G - C T A T C T C T C A T G A A | | | | G T C T C G A A G A G C G | | | | T T G G A G C G A A GGGTC C - G C - G T - A G - C C - G C A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |