Sequence ID | >WENV182200603 |
Genome ID | OHPL01001567 |
Search identical group | |
Phylum/Class | [OHPL] human gut metagenome; feces |
Species | |
Start position on genome | 8512 |
End posion on genome | 8586 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
caacatcagc |
tRNA gene sequence |
GGCGGGGTAGCCAAGTGGTAAGGCGACGGTCTGCAAAATCGTTATTCGCGGGTTCGATTC |
Downstream region at tRNA end position |
tgtttacttt |
Secondary structure (Cloverleaf model) | >WENV182200603 Cys GCA c TCCA tgtttacttt G - C G - C C - G G - C G - C G - C G + T T T T C G C C C A G A A | | | | | G T A C C G G C G G G C G | | | T T G A G G C T A G TATTC A - T C - G G - C G + T T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |