Sequence ID | >WENV182206296 |
Genome ID | OHPV01000277 |
Search identical group | |
Phylum/Class | [OHPV] human gut metagenome; feces |
Species | |
Start position on genome | 22673 |
End posion on genome | 22748 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
aagggtaagt |
tRNA gene sequence |
GCTTGGGTAGCTCAGTTGGTAGAGCAGTAGACTTTTAATCTATTGGTCCCGGGTTCGAGT |
Downstream region at tRNA end position |
ttcctttttt |
Secondary structure (Cloverleaf model) | >WENV182206296 Lys TTT t ACCA ttcctttttt G + T C - G T - A T - A G - C G - C G + T T G T G G C C C A T G A A | | | | | G T C T C G C C G G G C G | | | | T T G G A G C T A A TGGTC G + T T - A A - T G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |