| Sequence ID | >WENV182210966 |
| Genome ID | OHQE01006220 |
| Phylum/Class | [OHQE] human gut metagenome; feces |
| Species | |
| Start position on genome | 374 |
| End posion on genome | 448 |
| Amino Acid | Thr |
| Anticodon | GGT |
| Upstream region at tRNA start position |
caagtattca |
| tRNA gene sequence |
GCCCATGTGGCTCAGTGGTAGAGCACTCCCTTGGTAAGGGAGAGGTCACGCGTTCGATCC |
| Downstream region at tRNA end position |
gtttctttca |
| Secondary structure (Cloverleaf model) | >WENV182210966 Thr GGT
a ACCA gtttctttca
G - C
C - G
C - G
C - G
A - T
T - A
G - C C T
T T G C G C A
G A G | | | | | G
T C T C G A C G C G C
G | | | | T T
G G A G C
T A A AGGTC
C - G
T - A
C - G
C - G
C - G
T A
T A
G G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |