Sequence ID | >WENV182220297 |
Genome ID | OHQS01000059 |
Search identical group | |
Phylum/Class | [OHQS] human gut metagenome; feces |
Species | |
Start position on genome | 107471 |
End posion on genome | 107546 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
tgtgaagcaa |
tRNA gene sequence |
GGGCGTTTAGCTCAGCTGGTTTAGAGCATCTGCCTTACAAGCAGAGGGTCGGCGGTTCGA |
Downstream region at tRNA end position |
tagaaaagat |
Secondary structure (Cloverleaf model) | >WENV182220297 Val TAC a ACaa tagaaaagat G - C G - C G - C C - G G - C T - A T - A T A T C T G C C A T C G A A | + | | | G G C T C G G G C G G C G | | | | T T T G A G C T T A A GGGTC T - A C - G T - A G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |