Sequence ID | >WENV182232583 |
Genome ID | OHRO01006247 |
Search identical group | |
Phylum/Class | [OHRO] human gut metagenome; feces |
Species | |
Start position on genome | 691 |
End posion on genome | 765 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
attatttctc |
tRNA gene sequence |
GGGGTATTAGCTCATCTGGCTAGAGCGTTAGACTGGCAGTCTAAAGGTGGCGAGTTCGAG |
Downstream region at tRNA end position |
ttttaatgat |
Secondary structure (Cloverleaf model) | >WENV182232583 Ala GGC c ACtt ttttaatgat G - C G - C G + T G - C T + G A - T T - A T G T C G C T C A C T A A | | | | | G T C T C G G C G A G C G | | | | T T G G A G C C T A G AGGTG T - A T - A A - T G - C A - T C G T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |