Sequence ID | >WENV182237290 |
Genome ID | OHRW01003953 |
Search identical group | |
Phylum/Class | [OHRW] human gut metagenome; feces |
Species | |
Start position on genome | 399 |
End posion on genome | 326 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
agcaacacat |
tRNA gene sequence |
GCGGTAGTAGCTCAGTTGGCAGAGCGGCGGCTTCCCAAGCCGCAGGTCACGAGTTCGACC |
Downstream region at tRNA end position |
aagtttatct |
Secondary structure (Cloverleaf model) | >WENV182237290 Gly CCC t TCaa aagtttatct G - C C - G G - C G - C T - A A - T G - C C C T C G C T C A T G A A | | | | G T C T C G A C G A G C G | | | | T T G G A G C C A G AGGTC G - C C - G G - C G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |