Sequence ID | >WENV182242019 |
Genome ID | OHSG01008450 |
Search identical group | |
Phylum/Class | [OHSG] human gut metagenome; feces |
Species | |
Start position on genome | 1755 |
End posion on genome | 1830 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
ttcccaatat |
tRNA gene sequence |
GCGGCCGTAGCTCATCTGGTAGAGCGCCACCTTGCCAAGGTGGAGGTAGCGAGTTCGAGC |
Downstream region at tRNA end position |
atacgaagcc |
Secondary structure (Cloverleaf model) | >WENV182242019 Gly GCC t TCCA atacgaagcc G - C C - G G - C G - C C - G C - G G - C C G T T G C T C A C T A A + | | | | G T C T C G G C G A G C G | | | | T T G G A G C T A G AGGTA C - G C - G A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |