Sequence ID | >WENV182256463 |
Genome ID | OHTE01002092 |
Search identical group | |
Phylum/Class | [OHTE] human gut metagenome; feces |
Species | |
Start position on genome | 1409 |
End posion on genome | 1333 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
cgccagatgT |
tRNA gene sequence |
CGGGGTGTTGCGCAGTTGGTAGCGCGCCTGCTTTGGGAGCAGGAGGCCGCGAGTTCGAGT |
Downstream region at tRNA end position |
tgcaaacgca |
Secondary structure (Cloverleaf model) | >WENV182256463 Pro TGG T ATCC tgcaaacgca C - G G - C G - C G + T G - C T - A G - C T G T C G C T C A T G A T | | | | | G T C G C G G C G A G C G | | | | T T G G C G C T A G AGGCC C - G C - G T - A G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |