Sequence ID | >W141224555 |
Genome ID | BAIN01000009 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Acetobacter papayae JCM 25143 [BAIN] |
Start position on genome | 52282 |
End posion on genome | 52208 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
tccaccataa |
tRNA gene sequence |
TGGGGCGTAGCCAAGCGGTAAGGCAGCGGATTTTGATTCCGCCATGCGGAGGTTCGAATC |
Downstream region at tRNA end position |
ttttttccag |
Secondary structure (Cloverleaf model) | >W141224555 Gln TTG a GCCA ttttttccag T - A G - C G - C G - C G - C C - G G - C T A T C C T C C A G A A | | | | | G C A C C G G G A G G C G | | | T T G A G G C T A A CATGC G - C C - G G - C G - C A - T T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |