Sequence ID | >W141227920 |
Genome ID | BALN01000028 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Shewanella putrefaciens JCM 20190 [BALN] |
Start position on genome | 121 |
End posion on genome | 212 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
tagattttgc |
tRNA gene sequence |
GGAGAGGTGGCCGAGTGGCCGAAGGCGCTCCCCTGCTAAGGGAGTATGGGCTTTAACTCC |
Downstream region at tRNA end position |
ttctatttct |
Secondary structure (Cloverleaf model) | >W141227920 Ser GCT c GCCA ttctatttct G - C G - C A - T G - C A - T G + T G - C T A T C T C C C A T G A G | | | | | G G G C C G G A G G G C G | | | T T C A G G C C G A G TATGGGCTTTAACTCCCATC C - G T - A C - G C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |