Sequence ID | >WENV182304303 |
Genome ID | OHWZ01002176 |
Search identical group | |
Phylum/Class | [OHWZ] human gut metagenome; feces |
Species | |
Start position on genome | 2743 |
End posion on genome | 2816 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
aacagaatat |
tRNA gene sequence |
GGACGGTTAGCTCAGCTGGTAGAGCATCTGCTTGACGTGCAGGAGGTCACAGGTTCGAGT |
Downstream region at tRNA end position |
gtggaaaaga |
Secondary structure (Cloverleaf model) | >WENV182304303 Val GAC t ACtc gtggaaaaga G - C G - C A - T C - G G - C G - C T - A T G T T G T C C A C G A A | | | | | G T C T C G A C A G G C G | | | | T T G G A G C T A A AGGTC T + G C - G T - A G - C C - G T T T G G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |