Sequence ID | >WENV182311954 |
Genome ID | OHXU01001618 |
Search identical group | |
Phylum/Class | [OHXU] human gut metagenome; feces |
Species | |
Start position on genome | 3181 |
End posion on genome | 3107 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
gccacctcat |
tRNA gene sequence |
GCACGGATAGCTCAGTGGTAGAGCGGCTGTCTTACACACAGTTGGTCGGGGGTTCGAATC |
Downstream region at tRNA end position |
tcaataaacc |
Secondary structure (Cloverleaf model) | >WENV182311954 Val TAC t ACCA tcaataaacc G + T C - G A - T C - G G - C G - C A - T T A T C T C C C A G A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C T A G TGGTC G + T C - G T - A G - C T - A C C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |