Sequence ID | >WENV182313259 |
Genome ID | OHXY01000863 |
Search identical group | |
Phylum/Class | [OHXY] human gut metagenome; feces |
Species | |
Start position on genome | 803 |
End posion on genome | 876 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
aaagaaataT |
tRNA gene sequence |
GGCTCCATGGTCAAGCGGTTAAGACACCGCCCTTTCACGGCGGTAACAGGGGTTCAAATC |
Downstream region at tRNA end position |
tgtaagattt |
Secondary structure (Cloverleaf model) | >WENV182313259 Glu TTC T ATta tgtaagattt G - C G + T C - G T - A C - G C - G A - T T A T T C C C C A C G A G | | | | | A G A C T G A G G G G C G | | | T T T A G A C T A A TAAC C - G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |