Sequence ID | >W141230453 |
Genome ID | BATC01000002 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Brevundimonas abyssalis TAR-001 [BATC] |
Start position on genome | 102663 |
End posion on genome | 102588 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
acgccgaagc |
tRNA gene sequence |
GCCGGTTTAGCTCAGCTGGTAGAGCAGCGGTTTTGTAAACCGAAGGTCGCGGGTTCGATT |
Downstream region at tRNA end position |
tcaccttcga |
Secondary structure (Cloverleaf model) | >W141230453 Thr TGT c ACCA tcaccttcga G - C C - G C - G G - C G - C T - A T - A T T T C G T C C A C G A A | | + | | G T C T C G G C G G G C G | | | | T T G G A G C T A A AGGTC G A C - G G - C G - C T - A T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |